| Factor type | NifA/NtrC |
|---|---|
| SWISS-PROT | P23914 |
| SubtiList | BG10677 |
| Consensus seq. | |
| Comment | activator which regulates the neighboring operon note that -144:-130 and -108:-120 makes a palindromic structure |
| Link to | Phylogenetic profile , Weight matrix & Motif alignment |
| Regulated gene |
Operon | Sigma | Regulation | Absolute position | Location | Binding seq.(cis-element) | Exp. | Reference | Year |
|---|---|---|---|---|---|---|---|---|---|
| levD | levDEFG-sacC operon | SigL | Positive | 2762193..2762235 | -148:-106 | TATGAACCTGTATTAAATGGAACACCATTTTAATACAGGTTTA |
DP DB GS FT | Martin-Verstraete I, et al. | 1994 |
| levD | levDEFG-sacC operon | SigL | Positive | 2762156..2762179 | -92:-69 | AAGTGTTTCAACAACAAATTGCTA |
DP DB GS FT | Martin-Verstraete I, et al. | 1994 |