| Factor type | BglG family |
|---|---|
| SWISS-PROT | P39805 |
| SubtiList | BG10474 |
| Consensus seq. | |
| Comment | required for substrate-dependent induction and catabolite repression of bglPH |
| Link to | Phylogenetic profile |
| Regulated gene |
Operon | Sigma | Regulation | Absolute position | Location | Binding seq.(cis-element) | Exp. | Reference | Year |
|---|---|---|---|---|---|---|---|---|---|
| bglP | bglPH;aryl-beta-glucoside utilization | ND | Positive | 4034782..4034810 | +25:+53 | GGATTGTTACTGCGAAAGCAGGCAAAACC |
RO DP | Kruger S, et al. | 1996 |
| bglS | licT-bglS | ND | Positive | ND | ND | ND |
licT-mutant | Schnetz K et al. | 1996 |