| Factor type | MerR family |
|---|---|
| SWISS-PROT | ND |
| SubtiList | BG12482 |
| Consensus seq. | |
| Comment | The N-terminal domain of Mta(MtaN) acts as a constitutive activator of the transcription of bmr and blt genes, |
| Link to | Phylogenetic profile , Weight matrix & Motif alignment |
| Regulated gene |
Operon | Sigma | Regulation | Absolute position | Location | Binding seq.(cis-element) | Exp. | Reference | Year |
|---|---|---|---|---|---|---|---|---|---|
| blt | blt-bltD | ND | Positive | 2716095..2716116 | -35:-14 | GACTATACGGTAACCATATACC |
Nothern-blot FT | Baranova NN et al. | 1999 |
| bmr | bmr | ND | Positive | 2493784..2493805 | -35:-14 | GACTCTCCCCTAGGAGGAGGTC |
Nothern-blot FT | Baranova NN et al. | 1999 |
| mta | ND | ND | Positive | 3763956..3763978 | -35:-13 | GACCCTAACGTTGCGTGATTGTT |
Nothern-blot FT | Baranova NN et al. | 1999 |
| ydfK | ND | ND | Positive | ND | ND | ND |
Nothern-blot | Baranova NN et al. | 1999 |