| Factor type | Unique(RNA POLYMERASE SIGMA FACTORS) |
|---|---|
| SWISS-PROT | P21344 |
| SubtiList | BG10747 |
| Consensus seq. | |
| Comment | shows partial homology with the N-terminal core binding domain of sigma factors and a helix-turn-helix motif stimulates the expression of several extracellular protein genes during the onset of stationary phase a 9bp sequence (TTTAGATAA) might be the binding consensus |
| Link to | Phylogenetic profile |
| Regulated gene |
Operon | Sigma | Regulation | Absolute position | Location | Binding seq.(cis-element) | Exp. | Reference | Year |
|---|---|---|---|---|---|---|---|---|---|
| aprE | ND | ND | Positive | ND | -415:-177 | ND |
DP HB | McCready PM, et al. | 1992 |
| senS | ND | ND | Negative? | 958591..958619 | ND | AAGGCTCTTATCGTTTAGATAAGGGCCTT |
RO HB DB HM | Wang LF, et al. | 1990 |