| Factor type | GntR |
|---|---|
| SWISS-PROT | P39796 |
| SubtiList | BG11011 |
| Consensus seq. | |
| Comment | repressor of the Tre operon which contains at least treP and treA treR is located downstream of treA binding sites are palindromes trehalose-6-phosphate probably acts as an inducer |
| Link to | Phylogenetic profile |
| Regulated gene |
Operon | Sigma | Regulation | Absolute position | Location | Binding seq.(cis-element) | Exp. | Reference | Year |
|---|---|---|---|---|---|---|---|---|---|
| treP | ND | SigA | Negative | 849619..849652 | -38:-5 | GTGTTGACTACCTGTATATACAGGAATACAATAT |
DB GS HB | Schock F, et al. | 1996 |
| treP | ND | SigA | Negative | 849652..849683 | +6:+17 | TGATTATAAGTTGTATATACAAGTTATAAAAA |
DB GS HB | Schock F, et al. | 1996 |