 |
Copyright: Human Genome Center, Inst. Med. Sci., Univ. Tokyo; 1999-2006
Contact: Kenta Nakai |
| Regulated Operon: | ahrC-recN |
| Genes | Synonyms | Direction | Genome position | Function | COG ID | Genus clusters |
|---|---|---|---|---|---|---|
| ahrC | - | 2521555..2522004 | transcriptional regulator | COG1438 | ahrC-BAC | |
| recN | - | 2519788..2521518 | COG0497 | recN-STA recN-STR |
| Operon evidence: | Genome analysis |
|---|---|
| Reference: | Van Hoy BE & Hoch JA (1990) |
| Comments: | Northern blotting results in BSORF show an ahrC-recN transcript, a yqiBCDE-yqxC-ahrC-recN transcript, and a yqiE-yqxC-ahrC-recN transcript. |
| Terminator sequence | Absolute position | Position from stop codon | Free energy [kcal/mol] |
Downstream of |
|---|---|---|---|---|
| GGTAAGCTGCGCGAGAAGCGCAGCTTATTTTTTTCGTGC >>>>>>> <<<<<<< |
recN |
|