 |
Copyright: Human Genome Center, Inst. Med. Sci., Univ. Tokyo; 1999-2006
Contact: Kenta Nakai |
| Regulated Operon: | aldX |
| Genes | Synonyms | Direction | Genome position | Function | COG ID | Genus clusters |
|---|---|---|---|---|---|---|
| aldX | yxaS, yxbE | + | 4093000..4094337 | aldehyde dehydrogenase | COG1012 |
| Operon evidence: | Northern blotting (1.3 kb transcript); downstream gene is on the opposite strand |
|---|---|
| Reference: | Yoshida K, et al. (2000) |
| Comments: |
| Terminator sequence | Absolute position | Position from stop codon | Free energy [kcal/mol] |
Downstream of |
|---|---|---|---|---|
| CAAAAGGCGCTTCCTTAGAGGAGCGCCTTTTATTGTAACTCC >>>>>>>>>> <<<<<<<<< |
aldX |
|