Regulated Operon: | aroC |
Genes | Synonyms | Direction | Genome position | Function | COG ID | Genus clusters |
---|---|---|---|---|---|---|
aroC | - | 2411900..2412667 | 3-dehydroquinate dehydratase | COG0710 | aroF-BAC-1 aroF-STA |
Operon evidence: | Northern blotting (0.9 kb transcript); downstream gene is on the opposite strand |
---|---|
Reference: | Azevedo V, et al. (1993), Genbank L09228 |
Comments: |
Terminator sequence | Absolute position | Position from stop codon | Free energy [kcal/mol] |
Downstream of |
---|---|---|---|---|
AAAAACTCAAGCTATATAGCTTGAGTTTTTTTAATTATGG >>>>>>>> <<<<<<<< |
aroC |
|