 |
Copyright: Human Genome Center, Inst. Med. Sci., Univ. Tokyo; 1999-2006
Contact: Kenta Nakai |
| Regulated Operon: | atp |
| Genes | Synonyms | Direction | Genome position | Function | COG ID | Genus clusters |
|---|---|---|---|---|---|---|
| atpI | - | 3786643..3787026 | ATP synthase (subunit i) | |||
| atpB | - | 3785901..3786635 | ATP synthase (subunit a) | COG0356 | atpB-STA atpB-STR | |
| atpE | - | 3785643..3785855 | ATP synthase (subunit c) | COG0636 | atpE-BAC atpE-STA | |
| atpF | - | 3784968..3785480 | ATP synthase (subunit b) | COG0711 | atpF-STA atpF-STR | |
| atpH | - | 3784426..3784971 | ATP synthase (subunit delta) | COG0712 | ||
| atpA | - | 3782901..3784409 | ATP synthase (subunit alpha) | COG0056 | atpA-LAB atpA-STA atpA-STR atpC-STR | |
| atpG | - | 3781961..3782824 | ATP synthase (subunit gamma) | COG0224 | atpB-STR atpG-STA atpG-STR | |
| atpD | - | 3780514..3781935 | ATP synthase (subunit beta) | COG0055 | atpA-STR atpD-BAC atpD-LAB atpD-MYC atpD-STA atpD-STR | |
| atpC | - | 3780092..3780490 | ATP synthase (subunit epsilon) | COG0355 | atpC-BAC atpC-STA atpC-STR atpG-STR |
| Operon evidence: | Genome analysis; downstream gene is on the opposite strand |
|---|---|
| Reference: | Presecan E, et al. (1997) |
| Comments: |
| Terminator sequence | Absolute position | Position from stop codon | Free energy [kcal/mol] |
Downstream of |
|---|---|---|---|---|
| AAAAATCCTTCTCTTTATGAGAAGGATTTTTTTATGAACGC >>>>>>>> <<<<<<<< |
atpC |
|