 |
Copyright: Human Genome Center, Inst. Med. Sci., Univ. Tokyo; 1999-2006
Contact: Kenta Nakai |
| Regulated Operon: | braB |
| Genes | Synonyms | Direction | Genome position | Function | COG ID | Genus clusters |
|---|---|---|---|---|---|---|
| braB | + | 3027340..3028677 | branched-chain amino acid transporter | COG1114 |
| Operon evidence: | Genome analysis; upstream and downstream gene are on the opposite strand |
|---|---|
| Reference: | Lapidus A, et al. (1997), Genbank AF008220 |
| Comments: |
| Terminator sequence | Absolute position | Position from stop codon | Free energy [kcal/mol] |
Downstream of |
|---|---|---|---|---|
| CAGAACGCCTGCGTTATTGCGCAGGCGTTTTGTAATAAAAAA >>>>>>>>> <<<<<<<<< |
braB |
|