| Regulated Operon: | ccpA-motPS | 
| Genes | Synonyms | Direction | Genome position | Function | COG ID | Genus clusters | 
|---|---|---|---|---|---|---|
| ccpA | graR, alsA | - | 3043207..3044211 | transcriptional regulator (Lacl family) | COG1609 | ccpA-BAC ccpA-STA ccpA-STR | 
| ytxD | motP | - | 3042326..3043144 | COG1291 | ||
| ytxE | motS | - | 3041608..3042336 | COG1360 | 
| Operon evidence: | Northern blotting (2.7 kb transcript); downstream genes are on the opposite strand | 
|---|---|
| Reference: | Lapidus A, et al. (1997), Terahara N, et al. (2006), Genbank AF008220 | 
| Comments: | The readthrough terminator downstream of ccpA leads to a 1.1 kb monocistronic ccpA transcript. | 
  
| Terminator sequence | Absolute position | Position from stop codon | Free energy [kcal/mol]  | 
  Downstream of | 
|---|---|---|---|---|
| AAAAACGACCTCTTCGTAAAGGTCGTTTTTTACTTTGTTC >>>>>> <<<<<<  | 
  ytxE | |||
| AGAGCAAGCTTCACCTTTATGGTGAATTCTTGCTTTTTTCA >>>>> <<<<<  | 
  ccpA | 


  |