| Regulated Operon: | ccpA-motPS |
| Genes | Synonyms | Direction | Genome position | Function | COG ID | Genus clusters |
|---|---|---|---|---|---|---|
| ccpA | graR, alsA | - | 3043207..3044211 | transcriptional regulator (Lacl family) | COG1609 | ccpA-BAC ccpA-STA ccpA-STR |
| ytxD | motP | - | 3042326..3043144 | COG1291 | ||
| ytxE | motS | - | 3041608..3042336 | COG1360 |
| Operon evidence: | Northern blotting (2.7 kb transcript); downstream genes are on the opposite strand |
|---|---|
| Reference: | Lapidus A, et al. (1997), Terahara N, et al. (2006), Genbank AF008220 |
| Comments: | The readthrough terminator downstream of ccpA leads to a 1.1 kb monocistronic ccpA transcript. |
| Terminator sequence | Absolute position | Position from stop codon | Free energy [kcal/mol] |
Downstream of |
|---|---|---|---|---|
| AAAAACGACCTCTTCGTAAAGGTCGTTTTTTACTTTGTTC >>>>>> <<<<<< |
ytxE | |||
| AGAGCAAGCTTCACCTTTATGGTGAATTCTTGCTTTTTTCA >>>>> <<<<< |
ccpA |


|