Regulated Operon: | comER |
Genes | Synonyms | Direction | Genome position | Function | COG ID | Genus clusters |
---|---|---|---|---|---|---|
comER | comD, comED | + | 2640437..2641258 | COG0345 |
Operon evidence: | S1 nuclease mapping |
---|---|
Reference: | Hahn J, et al. (1993) |
Comments: | S1 nuclease mapping showed that transcription ends near the indicated stem-loop. |
Terminator sequence | Absolute position | Position from stop codon | Free energy [kcal/mol] |
Downstream of |
---|---|---|---|---|
AAAAACCATCGTTTTAGGAAACGATGGTTTTTGATTTCTGCG >>>>>>>>> <<<<<<<<< |
comER |
|