 |
Copyright: Human Genome Center, Inst. Med. Sci., Univ. Tokyo; 1999-2006
Contact: Kenta Nakai |
| Regulated Operon: | comER |
| Genes | Synonyms | Direction | Genome position | Function | COG ID | Genus clusters |
|---|---|---|---|---|---|---|
| comER | comD, comED | + | 2640437..2641258 | COG0345 |
| Operon evidence: | S1 nuclease mapping |
|---|---|
| Reference: | Hahn J, et al. (1993) |
| Comments: | S1 nuclease mapping showed that transcription ends near the indicated stem-loop. |
| Terminator sequence | Absolute position | Position from stop codon | Free energy [kcal/mol] |
Downstream of |
|---|---|---|---|---|
| AAAAACCATCGTTTTAGGAAACGATGGTTTTTGATTTCTGCG >>>>>>>>> <<<<<<<<< |
comER |
|