 |
Copyright: Human Genome Center, Inst. Med. Sci., Univ. Tokyo; 1999-2006
Contact: Kenta Nakai |
| Regulated Operon: | cypC |
| Genes | Synonyms | Direction | Genome position | Function | COG ID | Genus clusters |
|---|---|---|---|---|---|---|
| cypC | ybdT | + | 229513..230766 | fatty acid beta-hydroxylating cytochrome P450 | COG2124 |
| Operon evidence: | Northern blotting (1.3 kb transcript); upstream and downstream gene are on the opposite strand |
|---|---|
| Reference: | BSORF |
| Comments: |
| Terminator sequence | Absolute position | Position from stop codon | Free energy [kcal/mol] |
Downstream of |
|---|---|---|---|---|
| AAAAAGCTCTCTTCCTTTATCGAAGAGAGCTTTTTGATTACTTCT >>>>>>>>> <<<<<<<<< |
cypC |
|