 |
Copyright: Human Genome Center, Inst. Med. Sci., Univ. Tokyo; 1999-2006
Contact: Kenta Nakai |
| Regulated Operon: | dgk-dck |
| Genes | Synonyms | Direction | Genome position | Function | COG ID | Genus clusters |
|---|---|---|---|---|---|---|
| dgk | yaaG | - | 23144..23767 | deoxyguanosine kinase | COG1428 | dgk-BAC |
| dck | yaaF | - | 22494..23147 | deoxyadenosine/deoxycytidine kinase | COG1428 |
| Operon evidence: | Northern blotting; downstream genes are on the opposite strand |
|---|---|
| Reference: | BSORF |
| Comments: |
| Terminator sequence | Absolute position | Position from stop codon | Free energy [kcal/mol] |
Downstream of |
|---|---|---|---|---|
| AAAAAGTGAATCTCAGTCGAGATTCACTTTTTCTTTAAAATA >>>>>>>>> <<<<<<<<< |
dck |
|