 |
Copyright: Human Genome Center, Inst. Med. Sci., Univ. Tokyo; 1999-2006
Contact: Kenta Nakai |
| Regulated Operon: | gcvT-gcvPA-gcvPB |
| Genes | Synonyms | Direction | Genome position | Function | COG ID | Genus clusters |
|---|---|---|---|---|---|---|
| gcvT | yqhI | - | 2547477..2548565 | aminomethyltransferase (glycine cleavage system protein T) | COG0404 | gcvT-BAC gcvT-STA |
| gcvPA | yqhJ, gcvP | - | 2546101..2547447 | glycine decarboxylase (subunit 1) (glycine cleavage system protein P) | COG0403 | gcvPA-BAC gcvPA-BAC |
| gcvPB | yqhK, gcvP | - | 2544642..2546108 | glycine decarboxylase (subunit 2) (glycine cleavage system protein P) | COG1003 |
| Operon evidence: | Northern blotting (4.2 kb transcript) |
|---|---|
| Reference: | Yoshida K, et al. (2003) |
| Comments: | A potential readthrough terminator was found downstream of gcvPA (2.5 kb transcript). An internal promoter may exist upstream of gcvPA (2.8 kb transcript). |
| Terminator sequence | Absolute position | Position from stop codon | Free energy [kcal/mol] |
Downstream of |
|---|---|---|---|---|
| AAAAACAGCTGTCTACCAGACAGCTGTTTGCTTTATTTCTT >>>>>>>>> <<<<<<<<< |
gcvPB |
|