 |
Copyright: Human Genome Center, Inst. Med. Sci., Univ. Tokyo; 1999-2006
Contact: Kenta Nakai |
| Regulated Operon: | gutR |
| Genes | Synonyms | Direction | Genome position | Function | COG ID | Genus clusters |
|---|---|---|---|---|---|---|
| gutR | - | 664323..666812 | transcriptional regulator | COG0457 |
| Operon evidence: | Northern blotting (2.8 kb transcript); upstream and downstream genes are on the opposite strand |
|---|---|
| Reference: | Watanabe S, et al. (2003), Genbank AB007637 |
| Comments: |
| Terminator sequence | Absolute position | Position from stop codon | Free energy [kcal/mol] |
Downstream of |
|---|---|---|---|---|
| GGAAAGGCCAACTGAAGTCGCAGTTGGCCTTTCGTTTCTTATTA >>>>>>>>> <<<<<<<<< |
gutR |
|