 |
Copyright: Human Genome Center, Inst. Med. Sci., Univ. Tokyo; 1999-2006
Contact: Kenta Nakai |
| Regulated Operon: | hemEHY |
| Genes | Synonyms | Direction | Genome position | Function | COG ID | Genus clusters |
|---|---|---|---|---|---|---|
| hemE | + | 1085422..1086483 | uroporphyrinogen III decarboxylase | COG0407 | hemE-BAC hemE-STA | |
| hemH | hemF | + | 1086555..1087487 | ferrochelatase | COG0276 | hemH-BAC-1 hemH-BAC-2 hemH-STA |
| hemY | hemG | + | 1087502..1088914 | protoporphyrinogen IX and coproporphyrinogen III oxidase | COG1232 | hemY-STA |
| Operon evidence: | Northern blotting (3.7 kb transcript) |
|---|---|
| Reference: | Hansson M & Hederstedt L (1992) |
| Comments: |
| Terminator sequence | Absolute position | Position from stop codon | Free energy [kcal/mol] |
Downstream of |
|---|---|---|---|---|
| TAAAACCTCCGCTTTATCGCGGAGGTTTTTTTGATGTGCA >>>>>>> <<<<<<< |
hemY |
|