 |
Copyright: Human Genome Center, Inst. Med. Sci., Univ. Tokyo; 1999-2006
Contact: Kenta Nakai |
| Regulated Operon: | leuS |
| Genes | Synonyms | Direction | Genome position | Function | COG ID | Genus clusters |
|---|---|---|---|---|---|---|
| leuS | - | 3101678..3104092 | leucyl-tRNA synthetase | COG0495 | leuS-BAC leuS-STA leuS-STR |
| Operon evidence: | Genome analysis |
|---|---|
| Reference: | Vander Horn PB & Zahler SA (1992), Grundy FJ & Henkin TM (1993), Lapidus A, et al. (1997), Genbank AF008220 |
| Comments: | Based on homology, transcriptional readthrough is expected to occur at the stem-loop upstream of leuS if uncharged leucine tRNA binds to the T-box motif in the nascent mRNA transcript. The tRNA anticodon binds to the CUC codon in the sequence GAACUCACC in the leuS leader mRNA. |
| Binding factor |
Regulation | Location | Absolute position | Binding seq.(cis-element) | Experimental evidence |
|---|---|---|---|---|---|
| TrnS-Leu2 | Positive | ND | 3104229..3104246 | AACGAGGGTGGTACCGCG |
Vander Horn PB & Zahler SA (1992): HM |
| Terminator sequence | Absolute position | Position from stop codon | Free energy [kcal/mol] |
Downstream of |
|---|---|---|---|---|
| GAAAGTCTCTCGTCCCTTTTTGGGATGAGGGAGTTTTTTTTAGTTTGG >>>>>>>>>>> <<<<<<<<<<< |
leuS | |||
| AAAAATCCCCTTTGCCAAAAGGGGATTTTTTTTCATCAGT >>>>>>>> <<<<<<<< |
leuS |
|