| Regulated Operon: | mntH |
| Genes | Synonyms | Direction | Genome position | Function | COG ID | Genus clusters |
|---|---|---|---|---|---|---|
| mntH | ydaR | - | 490702..491979 | manganese transporter | COG1914 | x0384-BAC |
| Operon evidence: | Genome analysis; downstream genes are on the opposite strand |
|---|---|
| Reference: | Que Q & Helmann JD (2000) |
| Comments: |
| Binding factor |
Regulation | Location | Absolute position | Binding seq.(cis-element) | Experimental evidence |
|---|---|---|---|---|---|
| MntR | Negative at high Mn(II) concentration | ND | 492020..492039 | TAATTTGCCTTAAGGAAACT |
Que Q & Helmann JD (2000): DB GS RG HM |
| Terminator sequence | Absolute position | Position from stop codon | Free energy [kcal/mol] |
Downstream of |
|---|---|---|---|---|
| TTTCGATAAAAAAACCGGCTTCTAAAGCCGGTTTTTATTTTTCCGC >>>>>>> <<<<<<< |
mntH |


|