 |
Copyright: Human Genome Center, Inst. Med. Sci., Univ. Tokyo; 1999-2006
Contact: Kenta Nakai |
| Regulated Operon: | mrpABCDEFG |
| Genes | Synonyms | Direction | Genome position | Function | COG ID | Genus clusters |
|---|---|---|---|---|---|---|
| mrpA | yufT, shaA, ntrA | + | 3245723..3248047 | Na+/H+ antiporter | COG1009 | mrpA-BAC |
| mrpB | yufU | + | 3248040..3248471 | COG2111 | ||
| mrpC | yufV | + | 3248471..3248812 | COG1006 | ||
| mrpD | yufD | + | 3248805..3250286 | |||
| mrpE | + | 3250292..3250768 | ||||
| mrpF | yufC | + | 3250768..3251052 | probable efflux system for Na+ and cholate | COG2212 | |
| mrpG | yufB | + | 3251036..3251410 | COG1320 |
| Operon evidence: | Northern blotting (5.9 kb transcript); downstream genes are on the opposite strand |
|---|---|
| Reference: | Oudega B, et al. (1997), Ito M, et al. (1999), Genbank Z93932 |
| Comments: |
| Terminator sequence | Absolute position | Position from stop codon | Free energy [kcal/mol] |
Downstream of |
|---|---|---|---|---|
| ATAAGCAGCCGGACAGGCAGAGTTCCGGCTGTTTTTTTATTTCTTG >>>>>>>> <<<<<<<< |
mrpG |
|