Regulated Operon: | mscL |
Genes | Synonyms | Direction | Genome position | Function | COG ID | Genus clusters |
---|---|---|---|---|---|---|
mscL | ywpC | - | 3742293..3742685 | large conductance mechanosensitive channel protein | COG1970 | mscL-BAC mscL-STA mscL-STR |
Operon evidence: | Genome analysis; downstream gene is on the opposite strand |
---|---|
Reference: | Presecan E, et al. (1997), Genbank Z83337 |
Comments: |
Terminator sequence | Absolute position | Position from stop codon | Free energy [kcal/mol] |
Downstream of |
---|---|---|---|---|
AAAAAGATGCCGTTAGAAACGGCGTCTTTTTTTATCTCAAT >>>>>>>>> <<<<<<<<< |
mscL |
|