 |
Copyright: Human Genome Center, Inst. Med. Sci., Univ. Tokyo; 1999-2006
Contact: Kenta Nakai |
| Regulated Operon: | mscL |
| Genes | Synonyms | Direction | Genome position | Function | COG ID | Genus clusters |
|---|---|---|---|---|---|---|
| mscL | ywpC | - | 3742293..3742685 | large conductance mechanosensitive channel protein | COG1970 | mscL-BAC mscL-STA mscL-STR |
| Operon evidence: | Genome analysis; downstream gene is on the opposite strand |
|---|---|
| Reference: | Presecan E, et al. (1997), Genbank Z83337 |
| Comments: |
| Terminator sequence | Absolute position | Position from stop codon | Free energy [kcal/mol] |
Downstream of |
|---|---|---|---|---|
| AAAAAGATGCCGTTAGAAACGGCGTCTTTTTTTATCTCAAT >>>>>>>>> <<<<<<<<< |
mscL |
|