 |
Copyright: Human Genome Center, Inst. Med. Sci., Univ. Tokyo; 1999-2006
Contact: Kenta Nakai |
| Regulated Operon: | mtlR |
| Genes | Synonyms | Direction | Genome position | Function | COG ID | Genus clusters |
|---|---|---|---|---|---|---|
| mtlR | ydaA | + | 466687..468771 | transcriptional regulator | COG3711 |
| Operon evidence: | Northern blotting (2.1 kb transcript) |
|---|---|
| Reference: | Watanabe S, et al. (2003) |
| Comments: | Northern blotting results in BSORF show a ycsN and a ycsN-mtlR transcript. |
| Terminator sequence | Absolute position | Position from stop codon | Free energy [kcal/mol] |
Downstream of |
|---|---|---|---|---|
| CATGGCACACGTCAAAAATTTGGCGTGTGTTTTTCTGTGGATGG >>>>>>>>>> <<<<<<<<<< |
mtlR |
|