 |
Copyright: Human Genome Center, Inst. Med. Sci., Univ. Tokyo; 1999-2006
Contact: Kenta Nakai |
| Regulated Operon: | nap |
| Genes | Synonyms | Direction | Genome position | Function | COG ID | Genus clusters |
|---|---|---|---|---|---|---|
| nap | - | 591847..592749 | carboxylesterase NA | COG0596 |
| Operon evidence: | Northern blotting (0.9 kb transcript); downstream genes are on the opposite strand |
|---|---|
| Reference: | Yoshida K, et al. (2003) |
| Comments: |
| Terminator sequence | Absolute position | Position from stop codon | Free energy [kcal/mol] |
Downstream of |
|---|---|---|---|---|
| AAAAATAGAGTCCCTCTTATGGACTCTATTTTTCTTGGACAAA >>>>>>>> <<<<<<<< |
nap |
|