Regulated Operon: | nap |
Genes | Synonyms | Direction | Genome position | Function | COG ID | Genus clusters |
---|---|---|---|---|---|---|
nap | - | 591847..592749 | carboxylesterase NA | COG0596 |
Operon evidence: | Northern blotting (0.9 kb transcript); downstream genes are on the opposite strand |
---|---|
Reference: | Yoshida K, et al. (2003) |
Comments: |
Terminator sequence | Absolute position | Position from stop codon | Free energy [kcal/mol] |
Downstream of |
---|---|---|---|---|
AAAAATAGAGTCCCTCTTATGGACTCTATTTTTCTTGGACAAA >>>>>>>> <<<<<<<< |
nap |
|