| Regulated Operon: | pgi-yugMN |
| Genes | Synonyms | Direction | Genome position | Function | COG ID | Genus clusters |
|---|---|---|---|---|---|---|
| pgi | yugL | - | 3219769..3221124 | glucose-6-phosphate isomerase | COG0166 | pgi-STA |
| yugM | - | 3219339..3219710 | ||||
| yugN | - | 3218875..3219279 |
| Operon evidence: | Northern blotting (2.4 kb transcript) |
|---|---|
| Reference: | Ludwig H, et al. (2001), Genbank Z93936 |
| Comments: | The readthrough terminator downstream of pgi leads to a 1.5 kb transcript. Genbank Z93936 lists two other potential terminators, one inside yugM and one downstream of yugM. Both lack a T-stretch. |
| Terminator sequence | Absolute position | Position from stop codon | Free energy [kcal/mol] |
Downstream of |
|---|---|---|---|---|
| TAAGAGGAGGGGAAAGCATCGGCCCCTCCTTTTTTTGTATGCCT >>>>>>> <<<<<<< |
yugN | |||
| AGAAAGCTGACTGGCATTTGCCGGTCGGCTTTTTATAAAATCAG >>>>>>>>>> <<<<<<<<<< |
pgi |


|