 |
Copyright: Human Genome Center, Inst. Med. Sci., Univ. Tokyo; 1999-2006
Contact: Kenta Nakai |
| Regulated Operon: | pheT |
| Genes | Synonyms | Direction | Genome position | Function | COG ID | Genus clusters |
|---|---|---|---|---|---|---|
| pheT | - | 2926076..2928490 | phenylalanyl-tRNA synthetase (beta subunit) | COG0072 | pheS-LAB pheT-BAC pheT-CLO |
| Operon evidence: | Genome analysis; downstream gene is on the opposite strand |
|---|---|
| Reference: | Wipat A, et al. (1996) |
| Comments: |
| Terminator sequence | Absolute position | Position from stop codon | Free energy [kcal/mol] |
Downstream of |
|---|---|---|---|---|
| AAAAAGCTTGCAGAGAAATCTGCAAGCTTTTTTCTATGAACG >>>>>>>>> <<<<<<<<< |
pheT |
|