| Regulated Operon: | ppaC | 
| Genes | Synonyms | Direction | Genome position | Function | COG ID | Genus clusters | 
|---|---|---|---|---|---|---|
| ppaC | yybQ | + | 4167228..4168157 | inorganic pyrophosphatase | COG1227 | x1044-BAC x1044-STA | 
| Operon evidence: | Northern blotting; upstream and downstream gene are on the opposite strand | 
|---|---|
| Reference: | BSORF | 
| Comments: | 
| Terminator sequence | Absolute position | Position from stop codon | Free energy [kcal/mol]  | 
  Downstream of | 
|---|---|---|---|---|
| AAAAAGCATCCCGCGTCGGGATGCTTTTTCTTATTCACC >>>>>>>> <<<<<<<<  | 
  ppaC | 


  |