| Regulated Operon: | ppaC |
| Genes | Synonyms | Direction | Genome position | Function | COG ID | Genus clusters |
|---|---|---|---|---|---|---|
| ppaC | yybQ | + | 4167228..4168157 | inorganic pyrophosphatase | COG1227 | x1044-BAC x1044-STA |
| Operon evidence: | Northern blotting; upstream and downstream gene are on the opposite strand |
|---|---|
| Reference: | BSORF |
| Comments: |
| Terminator sequence | Absolute position | Position from stop codon | Free energy [kcal/mol] |
Downstream of |
|---|---|---|---|---|
| AAAAAGCATCCCGCGTCGGGATGCTTTTTCTTATTCACC >>>>>>>> <<<<<<<< |
ppaC |


|