| Regulated Operon: | qoxD |
| Genes | Synonyms | Direction | Genome position | Function | COG ID | Genus clusters |
|---|---|---|---|---|---|---|
| qoxD | ipa-40d | - | 3913338..3913712 | cytochrome aa3 quinol oxidase (subunit IV) | COG3125 |
| Operon evidence: | Genome analysis; upstream and downstream genes are on the opposite strand |
|---|---|
| Reference: | Presecan E, et al. (1997) |
| Comments: |
| Terminator sequence | Absolute position | Position from stop codon | Free energy [kcal/mol] |
Downstream of |
|---|---|---|---|---|
| AAAAACCCTCTTCAGTGGAAGAGGGTTTTTTGCTGTCTTC >>>>>>>> <<<<<<<< |
qoxD |


|