Regulated Operon: | rapJ |
Genes | Synonyms | Direction | Genome position | Function | COG ID | Genus clusters |
---|---|---|---|---|---|---|
rapJ | ycdE | + | 303982..305103 | response regulator aspartate phosphatase | COG0457 |
Operon evidence: | Northern blotting (1.0 kb transcript); upstream gene is on the opposite strand |
---|---|
Reference: | BSORF |
Comments: |
Terminator sequence | Absolute position | Position from stop codon | Free energy [kcal/mol] |
Downstream of |
---|---|---|---|---|
AAATGGCAGAGAACTACAGGTTCTCTGCTTTTTTTGTGCTGTT >>>>>>>>>> <<<<<<<<<< |
rapJ |
|