| Regulated Operon: | rapJ |
| Genes | Synonyms | Direction | Genome position | Function | COG ID | Genus clusters |
|---|---|---|---|---|---|---|
| rapJ | ycdE | + | 303982..305103 | response regulator aspartate phosphatase | COG0457 |
| Operon evidence: | Northern blotting (1.0 kb transcript); upstream gene is on the opposite strand |
|---|---|
| Reference: | BSORF |
| Comments: |
| Terminator sequence | Absolute position | Position from stop codon | Free energy [kcal/mol] |
Downstream of |
|---|---|---|---|---|
| AAATGGCAGAGAACTACAGGTTCTCTGCTTTTTTTGTGCTGTT >>>>>>>>>> <<<<<<<<<< |
rapJ |


|