Regulated Operon: | rnhC |
Genes | Synonyms | Direction | Genome position | Function | COG ID | Genus clusters |
---|---|---|---|---|---|---|
rnhC | ysgB | + | 2925099..2926040 | ribonuclease HIII | COG1039 | rnhC-STA |
Operon evidence: | Genome analysis; upstream and downstream genes are on the opposite strand |
---|---|
Reference: | Wipat A, et al. (1996) |
Comments: |
Terminator sequence | Absolute position | Position from stop codon | Free energy [kcal/mol] |
Downstream of |
---|---|---|---|---|
AAAAAGCTTGCAGATTTCTCTGCAAGCTTTTTTATCAGCCTC >>>>>>>>> <<<<<<<<< |
rnhC |
|