 |
Copyright: Human Genome Center, Inst. Med. Sci., Univ. Tokyo; 1999-2006
Contact: Kenta Nakai |
| Regulated Operon: | serA |
| Genes | Synonyms | Direction | Genome position | Function | COG ID | Genus clusters |
|---|---|---|---|---|---|---|
| serA | + | 2410280..2411857 | phosphoglycerate dehydrogenase | COG0111 | serA-BAC x0383-BAC |
| Operon evidence: | Northern blotting (1.6 kb transcript); upstream and downstream genes are on the opposite strand |
|---|---|
| Reference: | Azevedo V, et al. (1993), Genbank L47648 |
| Comments: |
| Terminator sequence | Absolute position | Position from stop codon | Free energy [kcal/mol] |
Downstream of |
|---|---|---|---|---|
| AAAAACTCAAGCTATATAGCTTGAGTTTTTTTATTGTTCT >>>>>>>> <<<<<<<< |
serA |
|