 |
Copyright: Human Genome Center, Inst. Med. Sci., Univ. Tokyo; 1999-2006
Contact: Kenta Nakai |
| Regulated Operon: | serS |
| Genes | Synonyms | Direction | Genome position | Function | COG ID | Genus clusters |
|---|---|---|---|---|---|---|
| serS | + | 20878..22155 | seryl-tRNA synthetase | COG0172 | serS-BAC serS-CLO serS-STR |
| Operon evidence: | Genome analysis |
|---|---|
| Reference: | Condon C, et al. (1996) |
| Comments: | Transcriptional readthrough occurs at the stem-loop upstream of serS if uncharged serine tRNA binds to the T-box motif in the nascent mRNA transcript. The tRNA anticodon binds to the UCC codon in the sequence GAAUCCAUC in the serS leader mRNA. |
| Binding factor |
Regulation | Location | Absolute position | Binding seq.(cis-element) | Experimental evidence |
|---|---|---|---|---|---|
| TrnD-Ser | Positive | ND | 20780..20803 | GTTTTCAATCAGGGTGGCAACGCG |
Condon C, et al. (1996): HM |
| Terminator sequence | Absolute position | Position from stop codon | Free energy [kcal/mol] |
Downstream of |
|---|---|---|---|---|
| CAACGCGAGAGCTCTCGTCCCTTTATGGGGATGAGGGCTCTTTTTATTTTCGATA >>>>>>>>>>>>>> <<<<<<<<<<<<<< |
serS | |||
| GTAAATTATGGAAAGGCGTGCCTGACAAGGTGCGCCTTTTTGCTTATGTAA >>>>>>>>> <<<<<<<<< |
serS |
|