 |
Copyright: Human Genome Center, Inst. Med. Sci., Univ. Tokyo; 1999-2006
Contact: Kenta Nakai |
| Regulated Operon: | sigY-yxlCDEFG |
| Genes | Synonyms | Direction | Genome position | Function | COG ID | Genus clusters |
|---|---|---|---|---|---|---|
| sigY | yxlB | - | 3969331..3969867 | RNA polymerase ECF(extracytoplasmic function)-type sigma factor (sigma-Y) | COG1595 | |
| yxlC | - | 3969018..3969338 | ||||
| yxlD | - | 3968815..3969021 | ||||
| yxlE | - | 3968630..3968818 | ||||
| yxlF | - | 3967736..3968623 | COG1131 | |||
| yxlG | - | 3966960..3967739 |
| Operon evidence: | Northern blotting (4.3 kb transcript) |
|---|---|
| Reference: | Tojo S, et al. (2003), Yoshida K, et al. (2000), Horsburgh MJ, et al. (2001) |
| Comments: | Both Tojo and Yoshida found mRNA transcripts (4.2 kb, 4.3 kb, and 4.8 kb) that extended into the coding region of the downstream yxlH gene. Horsburgh measured a 1.4 kb sigY transcript. |
| Binding factor |
Regulation | Location | Absolute position | Binding seq.(cis-element) | Experimental evidence |
|---|---|---|---|---|---|
| SigY | Promoter | -39:+1 | 3969897..3969937 | AAAGATGAACGCTTTTGAATCCGGTGTCGTCTCATAAGGCA |
Cao M, et al. (2003): RG AR PE Cao M, et al. (2002): AR |
| Terminator sequence | Absolute position | Position from stop codon | Free energy [kcal/mol] |
Downstream of |
|---|---|---|---|---|
| AAAAACGGCGTGATCTAAAGCGCCGATTGTTTTTTTCTGAG >>>>>> <<<<<< |
yxlG |
|