 |
Copyright: Human Genome Center, Inst. Med. Sci., Univ. Tokyo; 1999-2006
Contact: Kenta Nakai |
| Regulated Operon: | sipU |
| Genes | Synonyms | Direction | Genome position | Function | COG ID | Genus clusters |
|---|---|---|---|---|---|---|
| sipU | ycsB | + | 453584..454147 | type I signal peptidase | COG0681 | sipU-BAC |
| Operon evidence: | Northern blotting (0.6 kb transcript); downstream gene is on the opposite strand |
|---|---|
| Reference: | BSORF |
| Comments: |
| Terminator sequence | Absolute position | Position from stop codon | Free energy [kcal/mol] |
Downstream of |
|---|---|---|---|---|
| TGAAACGGTGCGGAGCCGGCTTTCCGCCCCGTTTTTTATGATAGAA >>>>>>>>>> <<<<<<<<<< |
sipU |
|