| Regulated Operon: | spo0M | 
| Genes | Synonyms | Direction | Genome position | Function | COG ID | Genus clusters | 
|---|---|---|---|---|---|---|
| spo0M | ygaI | - | 952707..953483 | COG4326 | 
| Operon evidence: | upstream and downstream genes are transcribed in the opposite direction | 
|---|---|
| Reference: | Han WD, et al. (1998) | 
| Comments: | 
| Binding factor | Regulation | Location | Absolute position | Binding seq.(cis-element) | Experimental evidence | 
|---|---|---|---|---|---|
| SigH | Promoter | ND | 953533..953574 | AATAATAGGAAAAAAGTATGAATCAAACGAATCTTTTTTCCT | Han WD, et al. (1998): DB, in vitro experiments | 
| Terminator sequence | Absolute position | Position from stop codon | Free energy [kcal/mol] | Downstream of | 
|---|---|---|---|---|
| AAAAAGGAGCCGAGGCTCCTTTTCTTTAATAAAA >>>>> <<<<< | spo0M | 


| 
 |