| Regulated Operon: | tyrZ | 
| Genes | Synonyms | Direction | Genome position | Function | COG ID | Genus clusters | 
|---|---|---|---|---|---|---|
| tyrZ | ipa-9r, tyrS1, tyrT | + | 3946179..3947420 | tyrosyl-tRNA synthetase | COG0162 | 
| Operon evidence: | Genome analysis | 
|---|---|
| Reference: | Henkin TM, et al. (1992), Presecan E, et al. (1997) | 
| Comments: | Transcriptional readthrough is presumed to occur at the stem-loop upstream of tyrZ if uncharged tyrosine tRNA (TrnD-Tyr) binds to the T-box motif in the nascent mRNA transcript. The tRNA anticodon binds to the UAC codon in the sequence AAUUACCUC in the tyrZ leader mRNA. | 
  
| Binding factor  | 
  Regulation | Location | Absolute position | Binding seq.(cis-element) | Experimental evidence | 
|---|---|---|---|---|---|
| TrnD-Tyr | Positive | ND | 3946099..3946115 | ACCAGGGTGGTACCGCG | 
  Henkin TM, et al. (1992): HM | 
| TrnSL-Tyr1 | Positive | ND | 3946099..3946115 | ACCAGGGTGGTACCGCG | 
  Henkin TM, et al. (1992): HM | 
| Terminator sequence | Absolute position | Position from stop codon | Free energy [kcal/mol]  | 
  Downstream of | 
|---|---|---|---|---|
| TACCGCGTGCATTGAGCCACGTCCCTTATTGGGATGGGCTCTTTTTTGTGTTTGTA >>>>>>>>>>>> <<<<<<<<<<<  | 
  tyrZ | |||
| CGAAACGCTTATGACCCTTCATTCATAAGCGTTTTTTTGCAGGTAT >>>>>>>>> <<<<<<<<<  | 
  tyrZ | 


  |