 |
Copyright: Human Genome Center, Inst. Med. Sci., Univ. Tokyo; 1999-2006
Contact: Kenta Nakai |
| Regulated Operon: | yaaDE |
| Genes | Synonyms | Direction | Genome position | Function | COG ID | Genus clusters |
|---|---|---|---|---|---|---|
| yaaD | + | 19060..19944 | COG0214 | yaaD-BAC | ||
| yaaE | + | 19966..20556 | COG0311 | yaaE-BAC |
| Operon evidence: | Northern blotting |
|---|---|
| Reference: | BSORF |
| Comments: | BSORF shows both a yaaDE transcript and a longer dacA-yaaDE-serS transcript |
| Terminator sequence | Absolute position | Position from stop codon | Free energy [kcal/mol] |
Downstream of |
|---|---|---|---|---|
| CGCGAGAGCTCTCGTCCCTTTATGGGGATGAGGGCTCTTTTTATTTTCGATA >>>>>>>>>>>>>> <<<<<<<<<<<<<< |
yaaE |
|