 |
Copyright: Human Genome Center, Inst. Med. Sci., Univ. Tokyo; 1999-2006
Contact: Kenta Nakai |
| Regulated Operon: | ycbCDEFGHJ |
| Genes | Synonyms | Direction | Genome position | Function | COG ID | Genus clusters |
|---|---|---|---|---|---|---|
| ycbC | + | 267881..268807 | COG0329 | ycbC-BAC | ||
| ycbD | + | 268837..270303 | COG1012 | ycbD-BAC | ||
| ycbE | + | 270387..271754 | COG0477 | |||
| ycbF | + | 271791..273158 | COG4948 | |||
| ycbG | + | 273228..273929 | COG2186 | |||
| ycbH | + | 274020..275552 | COG2721 | |||
| ycbJ | + | 275829..276749 | COG3173 |
| Operon evidence: | Northern blotting (8.3 kb transcript) |
|---|---|
| Reference: | Hosoya S, et al. (2002) |
| Comments: | Internal promoter in front of ycbG, leading to a 2.3 kb ybcGH transcript. Measured mRNA transcripts suggest that readthrough terminators may exist behind ycbG and ycbH, leading to a 5.9 kb ybcCDEFG transcript, a 0.8 kb ybcG transcript, a 7.4 ybcCDEFGH transcript, and a 2.3 kb ybcGH transcript. Northern blotting results in BSORF various transcripts in this region. |
| Terminator sequence | Absolute position | Position from stop codon | Free energy [kcal/mol] |
Downstream of |
|---|---|---|---|---|
| CGAGACCCTCGTCCTTTGCATAGGACGGGGGTTTTTTGTGTTTCTT >>>>>>>>>> <<<<<<<<<< |
ycbJ |
|