 |
Copyright: Human Genome Center, Inst. Med. Sci., Univ. Tokyo; 1999-2006
Contact: Kenta Nakai |
| Regulated Operon: | ycdB |
| Genes | Synonyms | Direction | Genome position | Function | COG ID | Genus clusters |
|---|---|---|---|---|---|---|
| ycdB | + | 300382..301800 |
| Operon evidence: | Northern blotting (1.8 kb transcript); upstream gene is on the opposite strand |
|---|---|
| Reference: | BSORF |
| Comments: |
| Terminator sequence | Absolute position | Position from stop codon | Free energy [kcal/mol] |
Downstream of |
|---|---|---|---|---|
| AAAAGGACCTTTCTTCACTTTAAATGAAGAAAGGTCTTTTTATATAATAAA >>>>>>>>>>>> <<<<<<<<<<<< |
ycdB |
|