 |
Copyright: Human Genome Center, Inst. Med. Sci., Univ. Tokyo; 1999-2006
Contact: Kenta Nakai |
| Regulated Operon: | ycxCB |
| Genes | Synonyms | Direction | Genome position | Function | COG ID | Genus clusters |
|---|---|---|---|---|---|---|
| ycxC | - | 404641..405579 | COG0697 | |||
| ycxB | - | 404030..404587 |
| Operon evidence: | Northern blotting (1.6 kb transcript) |
|---|---|
| Reference: | BSORF |
| Comments: | Northern blotting results in BSORF suggests the existence of an internal promoter in front of ycxB, leading to a 0.6 kb transcript. |
| Terminator sequence | Absolute position | Position from stop codon | Free energy [kcal/mol] |
Downstream of |
|---|---|---|---|---|
| AAAAAGGATCAGCATTGACAGTGCTGATCCTTTTATATTGAATGG >>>>>>>>>> <<<<<<<<<< |
ycxB |
|