 |
Copyright: Human Genome Center, Inst. Med. Sci., Univ. Tokyo; 1999-2006
Contact: Kenta Nakai |
| Regulated Operon: | ydbO |
| Genes | Synonyms | Direction | Genome position | Function | COG ID | Genus clusters |
|---|---|---|---|---|---|---|
| ydbO | + | 506427..507299 | COG0053 |
| Operon evidence: | upstream and downstream genes are on the opposite strand |
|---|---|
| Reference: | |
| Comments: |
| Terminator sequence | Absolute position | Position from stop codon | Free energy [kcal/mol] |
Downstream of |
|---|---|---|---|---|
| AAATTCAGTCACTTCTTCAGGCGTTTTGGCATTGGCGCTGTGAAGGTGAGCTGTTTTTTCACCGTTCT >>>>>>>>>>>>>>>>>>>> <<<<<<<<<<<<<<<<<<<< |
ydbO |
|