 |
Copyright: Human Genome Center, Inst. Med. Sci., Univ. Tokyo; 1999-2006
Contact: Kenta Nakai |
| Regulated Operon: | yfhFED |
| Genes | Synonyms | Direction | Genome position | Function | COG ID | Genus clusters |
|---|---|---|---|---|---|---|
| yfhF | - | 923969..924880 | COG1090 | |||
| yfhE | - | 923804..923914 | ||||
| yfhD | - | 923546..923737 |
| Operon evidence: | Northern blotting |
|---|---|
| Reference: | BSORF, Genbank D85082 |
| Comments: | Northern blotting results in BSORF show a yfhFED, a yfhED, and a monocistronic yfhE transcript. |
| Binding factor |
Regulation | Location | Absolute position | Binding seq.(cis-element) | Experimental evidence |
|---|---|---|---|---|---|
| SigF | Promoter | ND | ND | ND |
Kuwana R, et al. (2002): SDS-PAGE, RG |
| Terminator sequence | Absolute position | Position from stop codon | Free energy [kcal/mol] |
Downstream of |
|---|---|---|---|---|
| AAAAACCCCTTGTCTCCGTTTGAGACAAGGGGTTTTTTACATTTCAG >>>>>>>>>>> <<<<<<<<<<< |
yfhD |
|