| Regulated Operon: | yfhGH |
| Genes | Synonyms | Direction | Genome position | Function | COG ID | Genus clusters |
|---|---|---|---|---|---|---|
| yfhG | + | 924969..925763 | COG2137 | |||
| yfhH | + | 925765..926079 |
| Operon evidence: | Northern blotting |
|---|---|
| Reference: | BSORF, Genbank D85082 |
| Comments: | BSORF shows a yghGH and a monocistronic yfhH transcript, suggesting that an internal promoter exists upstream of yghH. |
| Terminator sequence | Absolute position | Position from stop codon | Free energy [kcal/mol] |
Downstream of |
|---|---|---|---|---|
| AACAGGAGGCTGATGATCAGCCTCTTTTTGTTTGCAGCA >>>>>>>> <<<<<<<< |
yfhH |


|