 |
Copyright: Human Genome Center, Inst. Med. Sci., Univ. Tokyo; 1999-2006
Contact: Kenta Nakai |
| Regulated Operon: | yfiGHI |
| Genes | Synonyms | Direction | Genome position | Function | COG ID | Genus clusters |
|---|---|---|---|---|---|---|
| yfiG | + | 899415..900863 | COG0477 | |||
| yfiH | + | 900890..901831 | COG1082 | |||
| yfiI | + | 901841..903022 | COG0673 |
| Operon evidence: | Northern blotting |
|---|---|
| Reference: | BSORF |
| Comments: | Northern blotting results in BSORF suggest the existence of internal promoters upstream of yfiH and yfiI. |
| Terminator sequence | Absolute position | Position from stop codon | Free energy [kcal/mol] |
Downstream of |
|---|---|---|---|---|
| ATGCGCCGCATATGACATAAAGTTCATATGCGGTTTTTATTTTCCAGA >>>>>>>>>>> <<<<<<<<<<<< |
yfiI |
|