 |
Copyright: Human Genome Center, Inst. Med. Sci., Univ. Tokyo; 1999-2006
Contact: Kenta Nakai |
| Regulated Operon: | yfiY |
| Genes | Synonyms | Direction | Genome position | Function | COG ID | Genus clusters |
|---|---|---|---|---|---|---|
| yfiY | - | 918702..919679 | COG0614 |
| Operon evidence: | Northern blotting; upstream and downstream genes are on the opposite strand |
|---|---|
| Reference: | BSORF, Genbank D85082 |
| Comments: |
| Binding factor |
Regulation | Location | Absolute position | Binding seq.(cis-element) | Experimental evidence |
|---|---|---|---|---|---|
| Fur | Negative | ND | ND | ND |
Baichoo N, et al. (2002): AR Ollinger J, et al. (2006): DB SDS-PAGE |
| Terminator sequence | Absolute position | Position from stop codon | Free energy [kcal/mol] |
Downstream of |
|---|---|---|---|---|
| AAAAAGACTCCGTCTTATTAGACGGAGTCTTTTTTGCTTTTGCC >>>>>>>>>> <<<<<<<<<< |
yfiY |
|