 |
Copyright: Human Genome Center, Inst. Med. Sci., Univ. Tokyo; 1999-2006
Contact: Kenta Nakai |
| Regulated Operon: | yfjABCDEF |
| Genes | Synonyms | Direction | Genome position | Function | COG ID | Genus clusters |
|---|---|---|---|---|---|---|
| yfjA | - | 888707..889021 | yfjA-BAC | |||
| yfjB | - | 887478..888701 | ||||
| yfjC | - | 886699..887466 | ||||
| yfjD | - | 886110..886667 | ||||
| yfjE | - | 885558..886016 | ||||
| yfjF | - | 885179..885508 | COG1742 |
| Operon evidence: | Northern blotting |
|---|---|
| Reference: | BSORF |
| Comments: | Northern blotting results in BSORF suggest the existence of an internal promoter upstream of yfjC. |
| Terminator sequence | Absolute position | Position from stop codon | Free energy [kcal/mol] |
Downstream of |
|---|---|---|---|---|
| CAAAATGGCCTGCTTATGAAGCGGGCCATTTTTGTTTAATCCT >>>>>>>>>> <<<<<<<<<< |
yfjF |
|