 |
Copyright: Human Genome Center, Inst. Med. Sci., Univ. Tokyo; 1999-2006
Contact: Kenta Nakai |
| Regulated Operon: | yflE |
| Genes | Synonyms | Direction | Genome position | Function | COG ID | Genus clusters |
|---|---|---|---|---|---|---|
| yflE | - | 841384..843333 | COG1368 |
| Operon evidence: | Northern blotting; upstream and downstream gene are on the opposite strand |
|---|---|
| Reference: | BSORF, Genbank D86417 |
| Comments: |
| Terminator sequence | Absolute position | Position from stop codon | Free energy [kcal/mol] |
Downstream of |
|---|---|---|---|---|
| AAAAAGCGGAGAGGTTGCCCTCTCCGCTTTTTTATTTGACAG >>>>>>>>> <<<<<<<<< |
yflE |
|