 |
Copyright: Human Genome Center, Inst. Med. Sci., Univ. Tokyo; 1999-2006
Contact: Kenta Nakai |
| Regulated Operon: | yfmIJ |
| Genes | Synonyms | Direction | Genome position | Function | COG ID | Genus clusters |
|---|---|---|---|---|---|---|
| yfmI | - | 818648..819868 | COG0477 | |||
| yfmJ | - | 817147..818166 | COG2130 |
| Operon evidence: | Northern blotting |
|---|---|
| Reference: | BSORF |
| Comments: | The Northern blotting results in BSORF suggest the existence of an internal promoter in front of yfmJ. |
| Terminator sequence | Absolute position | Position from stop codon | Free energy [kcal/mol] |
Downstream of |
|---|---|---|---|---|
| AAACGGGAGGGCTTTTTGCCCTCCTTTTGTGTTTCGATG >>>>>>> <<<<<<< |
yfmJ |
|