| Regulated Operon: | yhcM | 
| Genes | Synonyms | Direction | Genome position | Function | COG ID | Genus clusters | 
|---|---|---|---|---|---|---|
| yhcM | - | 987753..988208 | 
| Operon evidence: | upstream and downstream gene are on the opposite strand | 
|---|---|
| Reference: | Kuwana R, et al. (2002) | 
| Comments: | 
| Binding factor  | 
  Regulation | Location | Absolute position | Binding seq.(cis-element) | Experimental evidence | 
|---|---|---|---|---|---|
| SigF | Promoter | ND | ND | ND | 
  Kuwana R, et al. (2002): SDS-PAGE, RG | 
| Terminator sequence | Absolute position | Position from stop codon | Free energy [kcal/mol]  | 
  Downstream of | 
|---|---|---|---|---|
| CCTGGCCGTTAAAAAAACGTGTAATCCTCTTGGATTACACGTTTTCATATGTTACG >>>>>>>>>> <<<<<<<<<<  | 
  yhcM | 


  |