| Regulated Operon: | yhxA-glpP |
| Genes | Synonyms | Direction | Genome position | Function | COG ID | Genus clusters |
|---|---|---|---|---|---|---|
| yhxA | + | 999697..1001049 | COG0161 | |||
| glpP | + | 1001077..1001655 | transcription antiterminator | COG1954 | glpP-BAC glpP-STA x0199-BAC |
| Operon evidence: | Northern blotting (1.8-2.1 kb transcript) |
|---|---|
| Reference: | Holmberg C, et al. (1990), Beijer L, et al. (1993), Holmberg C & Rutberg L (1992) |
| Comments: | This terminator also functions as a terminator/anti-terminator for transcription of glpFK. Readthrough may occur. |
| Terminator sequence | Absolute position | Position from stop codon | Free energy [kcal/mol] |
Downstream of |
|---|---|---|---|---|
| CGGAGACCACAGCAGCTCTTTACGGCAAATGTTTATGCACCCGTAAAGCGGTTTGTTGTGGTTTTTTTATTCTCTTCTTCTCTATCATGCTTTTTAATCGTGA >>>>>>>>>>>>>>>>>>>>>>>> <<<<<<<<<<<<<<<<<<<<<<<<<< |
glpP |


|