 |
Copyright: Human Genome Center, Inst. Med. Sci., Univ. Tokyo; 1999-2006
Contact: Kenta Nakai |
| Regulated Operon: | yjcN |
| Genes | Synonyms | Direction | Genome position | Function | COG ID | Genus clusters |
|---|---|---|---|---|---|---|
| yjcN | + | 1264369..1264689 |
| Operon evidence: | Genome analysis; upstream gene is on the opposite strand |
|---|---|
| Reference: | |
| Comments: |
| Binding factor |
Regulation | Location | Absolute position | Binding seq.(cis-element) | Experimental evidence |
|---|---|---|---|---|---|
| Rok | Negative | ND | ND | ND |
Albano M, et al. (2005): RG AR DB GS |
| Terminator sequence | Absolute position | Position from stop codon | Free energy [kcal/mol] |
Downstream of |
|---|---|---|---|---|
| GAAAGCCTGCGGACACTGATCGTTTTACAGAGAAATTTGTGCTTCGATCGGTGTCCGTTTTTTTTCGCAACT >>>>>>>>>>>>>>>>>>>>>> <<<<<<<<<<<<<<<<<<<<<< |
yjcN |
|